SOS T-shirts?

[ItsPeanut]

Please dont make this site like OSO. Im still waiting for my stuff and havent gotten yet from their. I donated here and have not asked for anything yet, but please respect your friends.

 

[stecz20]

Please dont make this site like OSO. Im still waiting for my stuff and havent gotten yet from their. I donated here and have not asked for anything yet, but please respect your friends.

i dont really understand your post???

 

[MarylandMark]

Please dont make this site like OSO. Im still waiting for my stuff and havent gotten yet from their. I donated here and have not asked for anything yet, but please respect your friends.

STFU...

LOL- just kidding dude.

Bouy = talked to him on the phone just the other night. He likes busting my balls a bit and good comradely

Seltzer= I watch his wife shower thru the windows since he has a summer home 2 doors down from mine

Chris= saw me drink copious amounts of booze, stumble all over the place and not remember what happened or what was said for a week straight

bobcat= just met him in Key West last week he likes busting balls

Stecz= the leader

and so on...

This site may be new but some of the donkey's on it aren't and we have like to have fun- it's all good..

 

[stecz20]

the reason why this site atsrted is cause the fun was gone from oso... its winter time, and this is what the boards are about.. ball breaking and some inbetween boating stuff... tough times are here for some and i dont see a better way to get togetehr with your buds and break some balls.... the only reason this stuff is staying up is i have to pay off the mods and its winter.. by the time the spring rolls around, we are back to business as usual..... that will be all, carry on you pigs.....

we still have so much to bring you people, its only the begining... poor sunkin, were gonna bleed his ass dry.... big things are still coming, wait and see.. key west was small potatoes.......

 

[inbetween]

the reason why this site atsrted is cause the fun was gone from oso... and some inbetween boating ...

Aww shucks. Thanks guys. :seeya::biggrinjester::26::seeya:


FANTASTIC site. glad to be a part of it. Still waiting to order shirts though.:03:

 

[yesrej]

the reason why this site atsrted is cause the fun was gone from oso... its winter time, and this is what the boards are about.. ball breaking and some inbetween boating stuff... tough times are here for some and i dont see a better way to get togetehr with your buds and break some balls.... the only reason this stuff is staying up is i have to pay off the mods and its winter.. by the time the spring rolls around, we are back to business as usual..... that will be all, carry on you pigs.....

we still have so much to bring you people, its only the begining... poor sunkin, were gonna bleed his ass dry.... big things are still coming, wait and see.. key west was small potatoes.......

you are 100% right. we need to get drunk soon.

 

[Seltzer]

Seltzer= I watch his wife shower thru the windows since he has a summer home 2 doors down from mine

I always wondered why that milk crate kept showing up at the window.

 

[ILMORdude]

I need some coozies for my party school bus! Can never have enough of those bastards. Maybe a bigass SOS banner for the sides and rock em around the michigan poker runs! Hah

 

[cosmic12]

the only reason this stuff is staying up is i have to pay off the mods and its winter.. by the time the spring rolls around, we are back to business as usual....

QUOTE]

I haven't seen a dime yet or even a T-Shirt, pay up or we will have to start enforceing the new rules.:03: Pay UP and soon!!!:26::26::03::26::03:

 

[stecz20]

the only reason this stuff is staying up is i have to pay off the mods and its winter.. by the time the spring rolls around, we are back to business as usual....

QUOTE]

I haven't seen a dime yet or even a T-Shirt, pay up or we will have to start enforceing the new rules.:03: Pay UP and soon!!!:26::26::03::26::03:

When the world is mine, your death will be quick and painless... :03::03::03:

 

[phragle]

what does the dna of a steamer look like?

ccatgtggacctttgcaacctggctaacacacttgcctaagcgcgacgataattta
ggtacacctggaaacgttggaccgattgtgtgaacggattcgcgctgctattaaat

 

[NJgr8ful]

I need some shirts .. traveling to FL soon and need to fly our new colors

2XXLT few different colors

 

[stecz20]

I need some shirts .. traveling to FL soon and need to fly our new colors

2XXLT few different colors

yeah sure. lemme jump right on that... shall i overnight them as welll sir...:dupe::dupe:

 

[cosmic12]

yeah sure. lemme jump right on that... shall i overnight them as welll sir...:dupe::dupe:

Wait a min,Im still waiting payment. Mine first:sifone:

 

[NJgr8ful]

yeah sure. lemme jump right on that... shall i overnight them as welll sir...:dupe::dupe:

Sure, thought they woulda been here already :03:

((SERIOUSLY (get it?) though, I want to pay for them!! Not freebees like you Key West mooches got I just want .. NEED .. some shirts!!))

 

[stecz20]

Sure, thought they woulda been here already :03:

((SERIOUSLY (get it?) though, I want to pay for them!! Not freebees like you Key West mooches got I just want .. NEED .. some shirts!!))

we are wroking on it.... we just some things to do that are a little more imortant than t shirts for right now.. but we do promise, we will have some t shirts and such as soon as we can.... we promise..

 

[Bobcat]

until then we will establish an exchange program, everyone gets a shirt for one week , washing it is optional, one size fits all....................................